• Users Online: 463
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
ARTICLES
Year : 2012  |  Volume : 37  |  Issue : 2  |  Page : 140-145

Diagnostic value of T-cell receptor γ gene rearrangement in T-cell neoplasms


1 Department of Biochemistry, Damietta Faculty of Science, Mansoura University, Mansoura, Egypt
2 Molecular Hematology Laboratory, Department of Clinical Pathology, Oncology Center, Mansoura University, Mansoura, Egypt
3 Department of Pathology, Faculty of Medicine, Mansoura University, Mansoura, Egypt

Date of Submission15-Feb-2012
Date of Acceptance10-Mar-2012
Date of Web Publication23-Jun-2014

Correspondence Address:
Eman A. Soliman
Molecular Hematology Laboratory, Department of Clinical Pathology, Oncology Center, Mansoura University, 35516 Mansoura
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.7123/01.EJH.0000415064.50165.48

Rights and Permissions
  Abstract 

Background

The discrimination between reactive and malignant cell populations in some patients with suspected T-cell lymphoproliferative disorders can be complicated and less straightforward. Often, the dilemma lies in determining whether a population of lymphocytes is reactive or neoplastic. In such cases, T-cell receptor (TCR) gene clonality studies have proved useful as an additional diagnostic tool. The TCRγ gene is a preferred target for TCR gene clonality as it is rearranged at an early stage of T lymphoid development, rearranged in a large percent of T-cell neoplasms, and also because of its relative structural simplicity.

Materials and methods

In the present study, we used the BIOMED-2 multiplex primer panel to assess the value of TCRγ gene rearrangement using genescan analysis in 30 patients with suspected T-cell neoplasms and to elucidate its possible role in the diagnosis of such disorders.

Results

TCRγ gene clonality was detected in all 18 patients with suspected T-cell acute lymphoblastic leukemia/lymphoblastic lymphoma. In contrast, it was detected in nine out of 12 patients (75%) with suspected peripheral T-cell lymphoma. It is known that TCRγ monoclonality in peripheral T-cell lymphoma can be detected in patients with more aggressive disease in terms of both clinical presentation and laboratory results. VγfI was the most frequently used Vγ segment in our patients. The sensitivity and specificity of genescan were found to be 0.89 and 0.67, respectively, as compared with histopathology.

Conclusion

It is concluded that TCRγ gene clonality is a very useful diagnostic tool in T-cell neoplasms. As it is relatively simple, it can be used as a preliminary test for clonality assessment, followed by the more complex TCRβ gene rearrangement only in negative cases to improve sensitivity. In addition, it should be used together with heteroduplex and interpreted within the clinical context to improve its specificity.

Keywords: genescan, T-cell neoplasms, T-cell receptor γ


How to cite this article:
Habib SA, Salem DA, Soliman EA, Shaheen DA, Amin MM, Abdelghaffar HA. Diagnostic value of T-cell receptor γ gene rearrangement in T-cell neoplasms. Egypt J Haematol 2012;37:140-5

How to cite this URL:
Habib SA, Salem DA, Soliman EA, Shaheen DA, Amin MM, Abdelghaffar HA. Diagnostic value of T-cell receptor γ gene rearrangement in T-cell neoplasms. Egypt J Haematol [serial online] 2012 [cited 2019 Dec 14];37:140-5. Available from: http://www.ehj.eg.net/text.asp?2012/37/2/140/135069


  Introduction Top


Mature T-cell neoplasms as defined by the WHO represent a heterogeneous group of lymphoid malignancies including predominantly nodal entities, extranodal lymphomas, and T-cell leukemias. The classification of T-cell lymphomas has largely been made on the basis of morphological, immunohistochemical, clinical, and for some subtypes also on genotypic criteria 1–3. However, differentiation between nonneoplastic and neoplastic T cells remains difficult despite extensive immunostaining 4. In such cases, molecular gene rearrangement studies have proved useful as an additional diagnostic tool. Molecular clonality analysis is based on the fact that, in principle, all cells of a malignancy have a common clonal origin and show identically rearranged T-cell receptor (TCR) genes. The diagnosis of malignant T-cell proliferations is therefore supported by the finding of TCR gene clonality, whereas reactive lymphoproliferations show polyclonally rearranged TCR genes 5.

Gene rearrangement analysis can be performed using Southern blot-based and PCR-based techniques. Despite the high reliability of Southern blot analysis, it is increasingly being replaced by PCR techniques because of the higher efficiency and sensitivity of PCR. Moreover, PCR requires much less high-molecular-weight DNA 6. Of the four TCR genes, α, β, γ, and δ, TCRγ gene rearrangements have long been used for DNA PCR detection of lymphoid clonality. It is a preferential target for clonality analyses as it is rearranged at an early stage of T lymphoid development, probably just after TCRδ, in both TCRαβ and TCRγδ lineage precursors 7. It is rearranged in greater than 90% of T-cell acute lymphoblastic leukemia (T-ALL), T-large granular lymphocyte, and T-cell prolymphocytic leukemia, in 50–75% of peripheral T-cell non-Hodgkin lymphoma and mycosis fungoides. Unlike several other TCR loci, the complete genomic structure of the TCRγ gene has been known for many years. It contains a limited number of variable (V) and joining (J) γ segments; thus, the amplification of all major Vγ–Jγ combinations is possible with only a small number of V and J consensus primers 8–10.

In the present study, we used the BIOMED-2 multiplex panel 10 to assess the value of TCRγ gene rearrangement using genescan in a variety of morphologically and immunologically suspected human T-cell neoplasms and to clarify its potential role in the diagnosis of malignant T-cell lymphoproliferative disorders.


  Materials and methods Top


Patients’ samples

This study was performed on 30 patients referred to our laboratory from Oncology Center, Mansoura University (OCMU) after verbal consent and university ethics committee approval. These patients were highly suspected to have T-cell lymphoid neoplasm after clinical examination and laboratory investigations. Laboratory investigations included both routine and more advanced investigations used for the definitive diagnosis of T-cell lymphoid neoplasms. All patients’ peripheral blood (PB) and/or bone marrow (BM) samples were subjected to a morphological examination and flow cytometric immunophenotyping. In addition, other tissue samples (18 lymph node, 30 BM, seven mediastinal mass, and six other body swelling biopsies) according to the clinical presentation were subjected to microscopic examination using both hematoxylin and eosin (H&E) and immunohistochemistry (IHC). All samples were collected and recorded for their clinical and laboratory findings at time of the initial diagnosis.

Flow cytometric immunophenotyping

All patient samples were subjected to flow cytometric immunophenotyping using a Coulter Epics XL Flow cytometer (Coulter Corporation, Miami, Florida, USA) as a part of the diagnostic workup of T-cell neoplasms. The monoclonal antibodies (mAbs) were used in different combinations of fluorochromes, namely, fluorescein isothiocyanate, phycoerythrin, and phycoerythrin-cyanine 5. Different combinations of mAb were used against the following antigens: cCD3, cCD79a, MPO, TdT, CD1a, CD2, CD3, CD4, CD5, CD7, CD8, and CD34. Some of these mAb were used for the identification of the immature nature of cells (e.g. TdT and CD34), demarcation of the cell lineage (e.g. cCD3, cCD79a, MPO), or subclassification of T-cell neoplasms (e.g. CD1a, CD2, CD3, CD4, CD5, CD7, CD8). The mononuclear cells were stained for either surface or cytoplasmic mAb after permeabilization according to the manufacturer’s recommendations (Beckman Coulter, Villepinte, France). The cells were analyzed with the most appropriate blast gate using the combination of forward and side scatters with XL SYSTEM II acquisition software (XL system II) (Beckman Coulter, Miami, Florida, USA). An antigen was considered positive when the expression was at least 20% of the gated cells.

Immunohistochemical staining

Sections of 4 μm thickness were cut from formalin-fixed paraffin-embedded blocks of tissues specimens received at the Pathology Department of OCMU. Some of these sections were used for routine H&E, whereas others were prepared on charged slides for IHC. Immunohistochemical analysis was performed on tumor sections using antibodies with a labeled streptavidin–biotin–peroxidase complex technique. Antibodies against CD3 (1 : 500, rabbit anti-human, Cat No: A0452; Dako Cytomation, Santa Cruz, California, USA) and CD20 (1 : 300, mouse anti-human, Cat No: M0755; Dako Cytomation, Carpinteria, California, USA) were routinely used to determine T-cell and to exclude the B-cell lineage. Additional antibodies against CD5 (Dako Cytomation, Glostrup, Denmark, ready to use), CD15 (Leu-M1; Becton Dickinson, Synnyvale, California, USA), CD43 (1 : 50, mouse anti-human, Cat No: M0786; Dako Cytomation, Carpinteria, California, USA), CD30 (Dako Cytomation Glostrup, Denmark, ready to use), and CD56 (mouse monoclonal antibody, clone 123C3.D5; Zymed corporation product, San Francisco, California, USA, ready to use) were applied for subclassification. T-ALL/lymphoblastic lymphoma (LBL) was defined by blastic cytomorphology and the expression of CD99 (mouse anti-human, Cat No: IS057, ready to use; Dako Cytomation). Antigens were retrieved using the microwave heat-inducing method for all antibodies. All cases were evaluated and classified by a pathologist according to the criteria in the WHO classification of lymphoid neoplasm 2. Examination of three slides from each specimen was carried out on an Olympus CX31 light microscope (Olympus, Tokyo, Japan). Pictures were obtained by a PC-driven digital camera (Olympus E-620, Olympus, Tokyo, Japan). The computer software (Cell*; Olympus Soft Imaging Solution GmbH, Münster, Germany) allowed morphometric analysis to be performed.

Molecular analysis of T-cell receptor γ gene rearrangement

Extraction of DNA from PB/BM samples was carried out using the Qiagen QIAamp DNA mini prep kit (Cat No: 51304; Qiagen, Santa Clarita, California, USA) according to the manufacturer’s protocol. To detect TCRγ gene rearrangement, four Vγ primers were used for the next gene segments: Vγf1 (5ºGGAAGGCCCCACAGCRTCTT3º), Vγ9 (5ºCGGCACTGTCAGAAAGGAATC3º), Vγ10 (5ºAGCATGGGTAAGACAAGCAA3º), and Vγ11 (5ºCTTCCACTTCCACTTTGAAA3º). In addition, two Jγ reverse primers were used: Jγ1.1/2.1 (5ºTTACCAGGCGAAGTTACTATGAGC3º) and Jγ1.3/2.3 (5ºGTGTTGTTCCACTGCCAAAGAG3º). The reverse primers were fluorescently labeled with six FAM for post-PCR genescan analysis. These primers have been developed and standardized for the detection of clonality by BIOMED-2 concerted action 10. The detection requires the use of two separate PCR reactions, which vary only in the primers directed against the variable region gene segments, with the two Jγ primers being the same for both reactions (tube 1: VγfI+Vγ10+Jγ1.1/2.1+Jγ1.3/2.3, tube 2: Vγ9+Vγ11+Jγ1.1/2.1+Jγ1.3/2.3). The PCR mixture contained 0.125 μl of 100 mmol/l dNTPs set (Bioline Ltd, London, UK), 2.5 μl of 10× ABI buffer II (Applied Biosystems, Foster City, California, USA), 0.1 μl of Amplitaq gold 5 U/μl (Applied Biosystems), 1.5 μl of 25 mmol/l MgCl2 (Applied Biosystems), 10 pmol of each primer (Applied Biosystems), and 1 μl of extracted DNA, and the reaction was completed to 25 μl using deionized water. The amplification was carried out on a GeneAmp PCR System 9700 thermal cycler (Applied Biosystems) under the cycling conditions recommended by Van Dongen et al. 10: preactivation at 94°C for 15 min, then 35 cycles of denaturation at 91°C for 1 min, annealing at 63°C for 1 min, and extension at 72°C for 1 min, and finally postextension at 72°C for 20 min. TCRγ clonality was detected using genemapper software on an ABI Prism 310 Genetic Analyzer (Applied Biosystems). One microliter of PCR product was added to 10 μl deionized formamide (Applied Biosystems) and 1 μl of GeneScan 500 ROX internal size standard (Applied Biosystems) and introduced into the ABI310 genetic analyzer. Clonal populations appear as distinct peak(s), whereas a polyclonal population of T cells appears as a normally distributed Gaussian curve on the electrophoretogram, with no evidence of dominant peak(s) within it.


  Results Top


Clinical and laboratory data

The patients included in this study were divided into two groups according to clinical, morphological, and immunophenotyping findings; group I included patients suspected to have T-ALL/LBL (n=18) and group II included patients suspected to have peripheral T-cell lymphoma (PTCL) (n=12) [Table 1].
Table 1: Clinical, demographic, laboratory, and immunophenotypic data in groups I and II

Click here to view


It was found that all patients in group I did not present with body swelling in contrast to 50% of cases in group II (P=0.001). On the contrary, splenomegaly, fatigue, and hepatomegaly were present in the patients in group I more than that in group II (P=0.025, 0.046, and 0.063, respectively). It was also found that patients in group I had anemia more than those in group II (P=0.002), which may be responsible for the high percent of fatigue in this group [Table 1].

Immunophenotyping results

Immunophenotyping characterization was carried out using both flow cytometry (FC) on PB/BM mononuclear cells and IHC on available tissue sections. T-cell lineage demarcation was confirmed by the expression of at least one T-cell marker namely cCD3 with or without additional expression of other markers (surface CD3, CD5, or CD7 using FC, and CD5 or CD43 using IHC) and the absence of cCD79a and MPO using FC. The precursor nature of cells was established by the lymphoblastic morphology and the expression of TdT and CD34 using FC and CD99 using IHC. Accordingly, 18/30 patients (60%) were diagnosed with T-ALL/LBL and were included in group I [Table 1]. Although the remaining 12/30 patients (40%) were highly suspected to have mature T-cell neoplasm on the basis of clinical presentation, radiological findings, and other laboratory tests including H&E stain of the tissue sections, FC with the available markers in this study could not determine the malignant nature of such cases. In contrast, IHC showed a malignant nature in nine out of 12 patients; one of them was identified as natural killer cell type expressing CD56, two as CD30-positive anaplastic large T-cell lymphoma, and six as PTCL-not otherwise specified as none of them expressed CD56, CD15, or CD30. The remaining three patients were polyclonal, expressing both CD3 and CD20; one of them was diagnosed as reactive lymphadenopathy and two were diagnosed as lymphadenitis. The results of FC and IHC are shown in [Table 1] and examples of IHC are shown in [Figure 1]. It was found that CD7 and CD2 expressions were associated with group I (P=0.006, 0.05), whereas CD5 was associated more with group II (P=0.033) [Table 1].
Figure 1: Immunohistochemistry of different tissue sections. (a) T-cell lymphoma with CD3 expression (×400), (b) T-cell lymphoma with CD43 expression (×400), (c) natural killer-T-cell lymphoma with CD56 expression (×400), and (d) lymphoblastic lymphoma with CD99 expression (×400).

Click here to view


Molecular analysis of T-cell receptor γ gene rearrangement

It was found that all patients in group I had a monoclonal TCRγ gene rearrangement, whereas in group II, only nine out of 12 patients had monoclonality. It can be seen that Vγ1f was the mostly used Vγ segment in both groups [Table 2]. [Figure 2] shows examples of the genescan results. According to the TCRγ gene rearrangement, whether polyclonal or monoclonal, group II was subclassified into group IIa and group IIb, respectively.
Table 2: T-cell receptor γ clonality using genescan

Click here to view
Figure 2: T-cell receptor γ gene rearrangement in (a) T-cell acute lymphoblastic leukemia/lymphoblastic lymphoma case showing biallelic monoclonality at Vγ11 Jγ1.3/2.3 and Vγ11 Jγ1.1/2.1 loci with sizes of 104 and 115 bp, respectively. (b) Peripheral T-cell lymphoma (PTCL) case showing a monoclonal peak at the Vγ9 Jγ1.3/2.3 rearrangement with a size of 185 bp in a polyclonal background, (c) PTCL case showing a Gaussian-like distribution in the region between 160 and 200 bp (polyclonal), and (d) control sample showing a Gaussian polyclonal pattern.

Click here to view


It was found that TCRγ gene monoclonality was more related to a younger age and male sex. No patient in group IIa presented with hepatosplenomegaly, fever, loss of weight, fatigue, mediastinal mass, or bleeding tendency. Lactate dehydrogenase, uric acid, and erythrocyte sedimentation rate were higher in group IIb than in group IIa with P values of 0.017, 0.067, and 0.31, respectively [Table 3].
Table 3: Clinical, demographic, laboratory, and immunophenotypic data in groups IIa and IIb

Click here to view


On comparing the genescan clonality analysis with the IHC results in group IIb, it was found that the sensitivity and the specificity of genescan were 0.89 and 0.67, respectively, with a positive predictive value of 0.78 and a negative predictive value of 0.67 [Table 4].
Table 4: Sensitivity and specificity of T-cell receptor γ genescan analysis compared with immunohistochemistry

Click here to view



  Discussion Top


This study was performed on 30 patients highly suspected to have T-cell lymphoid neoplasm after clinical examination and laboratory investigations. Morphological examination and FC indicated that 18/30 patients had T-ALL/LBL (group I) and 12/30 patients had highly suspected PTCL (group II). The age range in group I at diagnosis was 32.5±15 years, with a male predominance (72.2%), which is in agreement with the published data 11–13. However, only one study in the USA reported a mean age of T-ALL/LBL of 22.8±18.7 years, which is lower than that in our study 14. In terms of the clinical presentation in the same patient group, lymphadenopathy, hepatomegaly, splenomegaly, mediastinal mass, and fatigue were detected in 55.6, 50, 66.7, 22.2, and 94.4% of the cases, respectively, which is in agreement with many previous studies 11, 12, 15.

In group II, the age at diagnosis was 42.5±18.3 years, with male predominance (58%). Lymphadenopathy, fatigue, and body swelling were found in 66.7, 66.7, and 50%, respectively. These data are in agreement with most published studies 16–18.

There was no statistically significant difference in the laboratory findings between group I and group II, except in the hemoglobin (Hb) concentration, which was much lower in group I (8.4±2.1 gm/dl) than that in group II (11.3±2.3 gm/dl), with a P value of 0.002. This lower Hb concentration in group I explains the high percent of fatigue detected in this group and is mostly because of the lower white blood cells doubling time in group I than that in group II [Table 1].

The frequently expressed antigens in group I after TdT, which was expressed in all 18 patients, were CD7 (88.9%), followed by CD34 (83.3%) and CD2 (61.1%), and this was in agreement with Thalhammer-Scherrer et al. 19. However, CD5 was the most consistent marker to be expressed in group II (83.3%). However, others have found a lower expression of CD5 but had larger samples 20. On comparing both groups, there was no significant difference in the immunologic markers expressed, except TdT, CD34, CD7, and CD5 [Table 1]. To our knowledge, no such comparison has been made before.

Although FC immunophenotyping is considered an excellent tool in the diagnosis of lymphoproliferative disorders, it played a limited role in the differentiation of malignant and reactive T-cell proliferation in our study. This may be because of the restricted mAb panel used and also because immunophenotyping was carried out on suspended cells, which do not reflect the anatomical distribution of the expressed antigens. Using IHC, only nine out of 12 patients were diagnosed with mature T-cell neoplasm.

In terms of the molecular clonality studies, nine out of 12 patients (75%) in group II showed a monoclonal TCRγ gene rearrangement, which is in agreement with Van Dongen et al. 10, who reported that TCRγ gene rearrangements were found in 50–75% of peripheral T-cell non-Hodgkin lymphoma. This patient group (group II) was subdivided according to the absence or presence of TCRγ gene clonality into group IIa (polyclonal) and group IIb (monoclonal) to study the relationship between clonality status and different demographic and laboratory findings and to assess the value of genescan in the diagnosis of PTCL.

It was found that monoclonality was associated with a younger age (35.7±16.02 year), with male predominance (7M : 2F), in contrast to polyclonal cases [Table 3]. Changes in both age and sex distributions were statistically significant, with P values of 0.017 and 0.018, respectively [Table 3].

All patients with polyclonal TCRγ rearrangement did not present with hepatosplenomegaly, loss of weight, fever, fatigue, mediastinal mass, or bleeding tendency. This did not reach statistical significance, except with fever and fatigue [Table 3]. Consequently, the absence of such clinical presentations may indicate polyclonality, which in turn may indicate the absence of malignancy or at least less aggressive disease.

In terms of the laboratory tests, there was no statistically significant variation between groups IIa and IIb, except for lactate dehydrogenase, which was significantly associated with group IIb (P=0.017). However, it was found that group IIa had a higher Hb content and platelet count, a lower total leukocytic count, absolute lymphocytic count, uric acid, and erythrocyte sedimentation rate, and showed normal liver function compared with group IIb. Nevertheless, these changes did not reach statistical significance [Table 3]. These data, together with the absence of the clinical presentations mentioned before, may again indicate the value of clonality detection in patients suspected to have PTCL.

In terms of the Vγ segment usage within group IIb, VγfI was the most frequently used Vγ segment (66.7%), followed by Vγ9 (22.2%) and Vγ10 (11.1%). Van Dongen et al. 21 found that the frequencies of VγfI and Vγ9 usage in PTCL were 80 and 16%, respectively, with a rare usage of Vγ10. The slightly different percentages may be because of the small sample sizes in our study. On comparing the genescan results with the IHC results [Table 4], it was found that the sensitivity and specificity of genescan were 0.89 and 0.67, respectively, compared with histopathology. The achieved sensitivity of TCRγ genescan clonality analysis in our study (89%) is not bad when putting in concern the simple methodology compared with TCRβ genescan clonality analysis which is better to be conserved for such cases. However, low specificity (67%) may represent a major problem in the TCRγ genescan clonality and this is because of the limited junctional diversity and the absence of D segments, together with the relatively limited nucleotide addition. It is therefore highly recommended that cases with clonal TCRγ identified by genescan analysis be subjected to analysis using high-resolution electrophoresis or PCR products be separated on the basis of criteria other than size in order to reduce the risk of false-positive results. It is also important to pay attention to canonical rearrangements – which do not show N-nucleotide additions – and the situations in which they occur most commonly. The most commonly recognized human canonical TCRγ rearrangement involves the Vγ9–Jγ1.2 segments and occurs in approximately 1% of blood T-lymphocytes and increases in frequency with age, as they result from the accumulation of TCRγδ-positive T-lymphocytes 22–24.

In conclusion, TCRγ gene clonality is very valuable as a diagnostic tool for T-cell neoplasms, which are usually considered as a diagnostic challenge. As it is a simple analysis, it could be used as a first-round test to assess clonality, followed by TCRβ gene rearrangement only in negative cases to improve sensitivity. Also, it should be accompanied by another method that is not based only on the PCR product size (e.g. heteroduplex) to decrease the potential risk of false-positive results caused by overinterpretation of minor clonal peaks. Most importantly, not only TCRγ clonality results but also a combination of methodologies – cytomorphology, FC, IHC, and cytogenetics – should be used within their clinical context.[24]

 
  References Top

1.Harris NL, Jaffe ES, Stein H, Banks PM, Chan JKC, Cleary ML, et al. A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood. 1994;84:1361–1392  Back to cited text no. 1
    
2.Jaffe ES, Harris N, Stein H, Vardiman JW Tumours of haematopoietic and lymphoid tissues. World Health Organization classification of tumours. 2001 Lyon IARC Press  Back to cited text no. 2
    
3.Armitage JO. A clinical evaluation of the International Lymphoma Study Group classification of non-Hodgkin’s lymphoma. Blood. 1997;89:3909–3918  Back to cited text no. 3
    
4.Brüggemann M, White H, Gaulard P, Garcia Sanz R, Gameiro P, Oeschger S, et al. Powerful strategy for polymerase chain reaction-based clonality assessment in T-cell malignancies Report of the BIOMED-2 Concerted Action BHM4 CT98-3936. Leukemia. 2007;21:215–221  Back to cited text no. 4
    
5.Sandberg Y, van Gastel Mol EJ, Verhaaf B, Lam KH, van Dongen JJM, Langerak AW. BIOMED-2 multiplex immunoglobulin/T-cell receptor polymerase chain reaction protocols can reliably replace Southern blot analysis in routine clonality diagnostics. J Mol Diagn. 2005;7:495–503  Back to cited text no. 5
    
6.Derksen PWB, Langerak AW, Kerkhof E, Wolvers Tettero ILM, Boor PPC, Mulder AH, et al. Comparison of different polymerase chain reaction-based approaches for clonality assessment of immunoglobulin heavy-chain gene rearrangements in B-cell neoplasia. Mod Pathol. 1999;12:794–805  Back to cited text no. 6
    
7.Blom B, Verschuren MCM, Heemskerk MHM, Bakker AQ, Van Gastel Mol EJ, Wolvers Tettero ILM, et al. TCR gene rearrangements and expression of the pre-T cell receptor complex during human T-cell differentiation. Blood. 1999;93:3033–3043  Back to cited text no. 7
    
8.Van Dongen JJM, Wolvers Tettero ILM. Analysis of immunoglobulin and T cell receptor genes. Part II: possibilities and limitations in the diagnosis and management of lymphoproliferative diseases and related disorders. Clin Chim Acta. 1991;198:93–174  Back to cited text no. 8
    
9.Szczepański T, Langerak AW, Wolvers Tettero ILM, Ossenkoppele GJ, Verhoef G, Stul M, et al. Immunoglobulin and T cell receptor gene rearrangement patterns in acute lymphoblastic leukemia are less mature in adults than in children: implications for selection of PCR targets for detection of minimal residual disease. Leukemia. 1998;12:1081–1088  Back to cited text no. 9
    
10.Van Dongen JJM, Langerak AW, Brüggemann M, Evans PAS, Hummel M, Lavender FL, et al. Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: report of the BIOMED-2 concerted action BMH4-CT98-3936. Leukemia. 2003;17:2257–2317  Back to cited text no. 10
    
11.Onciu M, Lai R, Vega F, Bueso Ramos C, Medeiros LJ. Precursor T-cell acute lymphoblastic leukemia in adults: age-related immunophenotypic, cytogenetic and molecular subsets. Am J Clin Pathol. 2002;117:252–258  Back to cited text no. 11
    
12.Hoelzer D, Gökbuget N. T-cell lymphoblastic lymphoma and T-cell acute lymphoblastic leukemia: a separate entity? Clin Lymphoma Myeloma. 2009;9(Suppl 3):S214–S221  Back to cited text no. 12
    
13.Marks DI, Paietta EM, Moorman AV, Richards SM, Buck G, DeWald G, et al. T-cell acute lymphoblastic leukemia in adults: clinical features, immunophenotype, cytogenetics and outcome from the large randomized prospective trial (UKALL XII/ECOG 2993). Blood. 2009;114:5136–5145  Back to cited text no. 13
    
14.Han X, Kilfoy B, Zheng T, Holford TR, Zhu C, Zhu Y, et al. Lymphoma survival patterns by WHO subtype in the United States, 1973–2003. Cancer Causes Control. 2008;19:841–858  Back to cited text no. 14
    
15.Dakka N, Bellaoui H, Khattab M, Brahimi Horn MC, Aoued L, Bouzid N, et al. Immunologic profile and outcome of childhood acute lymphoblastic leukemia (ALL) in Morocco. J Pediatr Hematol Oncol. 2007;29:574–580  Back to cited text no. 15
    
16.Castillo JJ, Beltran BE, Bibas M, Bower M, Collins JA, Cwynarski K, et al. Prognostic factors in patients with HIV-associated peripheral T-cell lymphoma: a multicenter study. Am J Hematol. 2011;86:256–261  Back to cited text no. 16
    
17.Uherova P, Ross CW, Finn WG, Singleton TP, Kansal R, Schnitzer B. Peripheral T-cell lymphoma mimicking marginal zone B-cell lymphoma. Mod Pathol. 2002;15:420–425  Back to cited text no. 17
    
18.Rüdiger T, Weisenburger DD, Anderson JR, Armitage JO, Diebold J, MacLennan KA, et al. Peripheral T-cell lymphoma (excluding anaplastic large-cell lymphoma): results from the non-Hodgkin’s lymphoma classification project. Ann Oncol. 2002;13:140–149  Back to cited text no. 18
    
19.Thalhammer-Scherrer R, Mitterbauer G, Simonitsch I, Jaeger U, Lechner K, Schneider B, et al. The immunophenotype of 325 adult acute leukemias: relationship to morphologic and molecular classification and proposal for a minimal screening program highly predictive for lineage discrimination. Am J Clin Pathol. 2002;117:380–389  Back to cited text no. 19
    
20.Knowles DM. Immunophenotypic and antigen receptor gene rearrangement analysis in T-cell neoplasia. Am J Pathol. 1989;134:761–785  Back to cited text no. 20
    
21.Van Dongen JJM, Szczepanski T, Adriaansen HJHenderson ES, Lister TA, Greaves MF. Immunobiology of leukemia. Leukemia. 2002 Philadelphia WB Saunders Co:85–129  Back to cited text no. 21
    
22.Delfau MH, Hance AJ, Lecossier D, Vilmer E, Grandchamp B. Restricted diversity of V(γ)9-JP rearrangements in unstimulated human γ/δ T lymphocytes. Eur J Immunol. 1992;22:2437–2443  Back to cited text no. 22
    
23.Porcelli S, Brenner MB, Band H. Biology of the human γδ T-cell receptor. Immunol Rev. 1991;120:137–183  Back to cited text no. 23
    
24.Breit TM, Wolvers Tettero ILM, Van Dongen JJM. Unique selection determinant in polyclonal Vδ2-Jδ1 junctional regions of human peripheral γδ T lymphocytes. J Immunol. 1994;152:2860–2864  Back to cited text no. 24
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and me...
Results
Discussion
Introduction
Materials and me...
Results
Discussion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed1168    
    Printed23    
    Emailed0    
    PDF Downloaded84    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]