Platelet glycoprotein VI genetic polymorphism T13254C in neonatal sepsis

Marina Mounir William Labib; Abeer Attia Saadeldin; Rania Ali El-Farrash; Mona Fathey Abdelfattah Hassan; Yasmin Nabil ElSakhawy; Menna Allah Zakaria Mohammad Ali Abou Elwafa

doi:10.4103/ejh.ejh_74_21

ORIGINAL ARTICLE

Year : 2022 | Volume : 47 | Issue : 3 | Page : 161-166

Platelet glycoprotein VI genetic polymorphism T13254C in neonatal sepsis

Marina Mounir William Labib¹, Abeer Attia Saadeldin¹, Rania Ali El-Farrash², Mona Fathey Abdelfattah Hassan¹, Yasmin Nabil ElSakhawy¹, Menna Allah Zakaria Mohammad Ali Abou Elwafa¹
¹ Department of Clinical Pathology, Ain Shams University, Cairo, Egypt
² Department of Pediatrics and Neonatology, Ain Shams University, Cairo, Egypt

Date of Submission	08-Oct-2021
Date of Acceptance	15-Nov-2021
Date of Web Publication	03-Jan-2023

Correspondence Address:
Marina Mounir William Labib
MSc of Clinical Pathology; Department of Clinical Pathology, Faculty of Medicine, Ain Shams University, Cairo
Egypt

Source of Support: None, Conflict of Interest: None

Check

DOI: 10.4103/ejh.ejh_74_21

Abstract

Background Neonatal sepsis is a global burden, being a leading cause of neonatal morbidity and mortality worldwide. Platelet glycoprotein VI (GPVI) affects sepsis at multiple stages of the inflammatory response. The expression of the GPVI receptor is genetically determined, thus influencing the coagulation processes. The authors focused in this study on the role of platelet GPVI genetic polymorphism T13254C (rs1613662) in neonatal sepsis in relation to other risk factors, laboratory tests, sepsis progression, and outcome. Methods The authors studied 50 neonates with early-onset sepsis. The authors detected platelet GPVI T13254C polymorphism using the TaqMan allelic discrimination method by the real-time polymerase chain reaction technique. Results The results showed that GPVI mutant polymorphic group was associated with higher D-dimer levels (P=0.032). Moreover, septic neonates with mutant homozygous type showed poor survival (P=0.047). However, GPVI mutant polymorphic types were not significantly related to other demographic, laboratory data, and different scoring systems, such as sepsis-induced coagulopathy score, International Society on Thrombosis and Hemostasis score, and Score for Neonatal Acute Physiology. Conclusion The authors found a relation between platelet GPVI T13254C polymorphism and D-dimer levels, hence suggesting a relation with neonatal sepsis-associated coagulopathy, which might further affect patients’ outcome.

Keywords: genetic polymorphism, glycoprotein VI, neonatal sepsis

How to cite this article:
Labib MM, Saadeldin AA, El-Farrash RA, Hassan MF, ElSakhawy YN, Abou Elwafa MZ. Platelet glycoprotein VI genetic polymorphism T13254C in neonatal sepsis. Egypt J Haematol 2022;47:161-6

How to cite this URL:
Labib MM, Saadeldin AA, El-Farrash RA, Hassan MF, ElSakhawy YN, Abou Elwafa MZ. Platelet glycoprotein VI genetic polymorphism T13254C in neonatal sepsis. Egypt J Haematol [serial online] 2022 [cited 2023 Mar 30];47:161-6. Available from: http://www.ehj.eg.net/text.asp?2022/47/3/161/358021

Background

Neonatal sepsis accounts yearly for up to one-third of neonatal deaths in the world. The World Health Organization considers neonatal sepsis as a major global health concern, with the highest burden especially in low- and middle-income countries [1].

Neonatal sepsis is a systemic infection occurring in infants at ≤28 days of life [2]. It is classified into early onset and late onset. Early-onset sepsis (EOS) is more fulminant, and it is commonly diagnosed within the first 48 h and almost always during the first week of life [3]. Several risk factors for EOS have been recognized, including preterm birth, low birth weight, rupture of membranes for longer than 18 h, and chorioamnionitis [4].

Platelet activation has an important role in the development of sepsis. During sepsis, platelet activation leads to endothelial cell injury and the formation of neutrophil extracellular traps (NETs) and microthrombi. The resultant induction of disseminated intravascular coagulation (DIC) leads to organ damage [5].

The glycoprotein VI (GPVI) protein is the platelet activator receptor for collagen [6]. Collagen has long been recognized as a potent physiologic agonist inducing platelet procoagulant activity [7]. It has been confirmed a possible participant in the process of platelet-induced NET formation [5]. It was also found to modulate inflammation and platelet–leukocyte complex formation at the primary site of infection during gram-negative-derived sepsis [8]. It has been proved that the expression of the GPVI receptor is genetically determined and that some polymorphisms in these genes affect their expression, thus influencing the coagulation processes [9].

The GPVI gene consists of eight exons and is mapped on chromosome 19q13.4 of the human genome [10]. To date, 10 common polymorphisms in the GPVI sequence have been identified; 5 of these are silent (synonymous) and 5 are nonsynonymous, thus encoding amino acid substitutions in the mature form of GPVI [6,11].

Most studies on the effect of genetic variation in GPVI have focused on the transition of thymine to cytosine at nucleotide 13254 in exon 5 (T13254C), which results in a serine to proline substitution in the stem region of GPVI at position 219 (219S>P). This nonconservative substitution could be expected to modify the structure and function of GPVI because this is a potential site for posttranslational modification [12].

In terms of prognostic information, Asfari etal. [13] identified a significant difference in the morbidity outcome for pediatric patients with sepsis with different GPVI haplotypes. Moreover, Montague etal. [14] proved it to be an important marker that predicts sepsis progression and possible mortality in the injured patients.

With the advancement of molecular genetic methods, genetic testing and screening of patient groups at high risk of sepsis may become a reality in the future [15]. Mapping the genetic basis of human diseases and their risk factors is important in the current trend of individualization of patient care [16]. This, however, necessitates further research to clarify in detail the role of the most powerful predictors in neonatal sepsis.

Aim of the work

The aim was to study the presence of platelet GPVI T13254C genetic polymorphism in early-onset full-term neonatal sepsis and correlate it with other standard risk factors, scores, and patient outcome.

Methods

Study design and setting

This prospective cohort study included 50 neonates with early-onset sepsis who were hospitalized in the neonatal intensive care unit of Ain Shams University Hospitals from October 2019 till October 2020.

On admission, all patients were subjected to complete history taking and thorough clinical examination. Laboratory investigations including complete blood picture, prothrombin time, activated partial thromboplastin time, D-dimer, fibrinogen level, C-reactive protein, blood culture, and platelet GPVI T13254C polymorphism were done. Sepsis-induced coagulopathy score (SIC), International Society on Thrombosis and Hemostasis score (ISTH), and Score for Neonatal Acute Physiology (SNAPII) scores were assessed. Follow-up of patients was done to record outcome and hospital length stay.

Inclusion criteria

The following were the inclusion criteria:

(1) Full-term neonates (gestational age ≥37 weeks).

(2) Early neonatal period of life (age from 0 to 5 days).

(3) Clinical signs, symptoms, and laboratory data of neonatal sepsis as demonstrated by the Tollner score [17].

Exclusion criteria

The following were the exclusion criteria:

(1) Preterm.

(2) Congenital anomalies/genetic abnormalities.

(3) Surgical intervention.

(4) Neonates on anticoagulants.

(5) Neonates of mothers on anticoagulants during pregnancy.

DNA extraction

DNA was extracted from the peripheral whole blood samples collected on ethylenediaminetetraacetic acid (EDTA) tubes using GeneJET™ Whole Blood Genomic DNA Purification Mini Kit (ThermoFisher Scientific, USA) according to the manufacturer protocol. The extracted DNA was stored at −20°C until analysis.

Taqman SNP genotyping assay

The platelet GPVI genetic polymorphism T13254C single-nucleotide polymorphism (rs1613662) was genotyped using fluorescently labeled probes [VIC/VAM] ACCCTGCAGAACCTACCTGCTACCG[A/G] GGAAGGTGGTTCTGTTGGTAACCGG and TaqMan Master Mix (Applied Biosystems, ThermoFisher Scientific). We used a real-time PCR instrument (Rotor-Gene Q real-time thermocycler by Qiagen, Hilden, Germany). The PCR conditions were as follows: initial AmpliTaq Gold DNA polymerase enzyme activation was done at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 s and then primer annealing/extension at 60°C for 1 min.

The system software uses the fluorescence measurements from each well made during the plate read in the ongoing run and then plots signal values. The software determines which alleles are in each sample for genotyping analysis.

Statistical analysis

Data were collected, revised, coded, and entered to the Statistical Package for the Social Sciences (IBM SPSS) version 23. The quantitative data with parametric distribution were presented as mean, SDs, and ranges, whereas nonparametric were presented as median with interquartile range. Moreover, qualitative variables were presented as number and percentages.

The comparison between groups regarding qualitative data was done using χ² test and Fisher’s exact test when the expected count in any cell was found less than 5. The comparison between two independent groups with quantitative data and parametric distribution was done by using independent t-test, whereas with nonparametric distribution was done using the Mann–Whitney test. The comparison between more than two independent groups with quantitative data and parametric distribution was done using one-way analysis of variance (ANOVA), whereas with nonparametric distribution was done using Kruskal-Wallis test. Regarding power of significance, the probability level (P value) was considered significant if P value was <0.05, nonsignificant if P value was ≥0.05, and highly significant if P value was <0.01.

Results

A total number of 50 full-term neonates with sepsis were investigated. Blood samples from all neonates were obtained and genotyped for platelet GPVI T13254C polymorphism; 31 patients (62%) were wild homozygous type (haplotype a), 16 patients (32%) were heterozygous mutant type (haplotype a/b), and 3 (6%) were homozygous mutant (haplotype b) ([Table 1]).

Table 1: Platelet glycoprotein VI (GPVI) polymorphic types

Click here to view

According to genotyping, patients were divided into two groups: wild group had 31 patients vs. mutant group had 19 patients, including heterozygous and homozygous mutant types ([Table 2]).

Table 2: Relation between platelet glycoprotein VI polymorphic subtypes and demographic and clinical data of the studied patients

Click here to view

Regarding laboratory results, D-dimer levels were significantly elevated in the mutant group than the wild homozygous group (2.26 vs. 1.51 μg/ml, P=0.032). As for the other laboratory data, there was no significant difference detected between the two groups ([Table 3]).

Table 3: Relation between platelet glycoprotein VI polymorphic subtypes and laboratory data of the studied patients

Click here to view

On admission, the patients were clinically assessed and different scores were calculated. SIC and ISTH were used to assess coagulopathy, whereas SNAPII was used to assess severity. No statistically difference was detected between the groups ([Table 4]).

Table 4: Relation between platelet GPVI polymorphic subtypes and different scores

Click here to view

The patients were followed during their hospital stay to record survival; four patients (12.5%) died with the wild genotype, two (12.5%) died with the heterozygous mutant type, and two (66.7%) died with the homozygous mutant type. There was higher percent of deaths in homozygous mutant (P=0.047) ([Table 5]).

Table 5: Relation between platelet GPVI polymorphic subtypes and outcome

Click here to view

Discussion

Recently, there has been great interest in linking genetic variation with the susceptibility to and severity of common multifactorial diseases such as neonatal sepsis [18,19]. Despite numerous studies about the role of genes in the pathogenesis of neonatal sepsis, many predictors have remained unveiled and are a major challenge to the research of neonatal sepsis [20].

In the present study, we focus on the platelet membrane receptor, GPVI, which contains common genotypic polymorphisms (haplotypes) associated with altered platelet GPVI-dependent signaling [13]. A growing body of evidence has also linked these haplotypes to pathologic responses in the acute setting, such as myocardial infarction [9,21] and stroke [22] and can also be predictive of pediatric sepsis severity [13].

We investigated the platelet GPVI gene polymorphism T13254C by SNP genotypic assay rs1613662. In our 50 patients, we found that 31 patients (62%) were wild homozygous type, 16 patients (32%) were heterozygous mutant type, and 3 patients (6%) were homozygous mutant type. This is in correlation with Asfari etal. [13] who studied 73 pediatric patients admitted to a pediatric intensive care unit with an initial diagnosis of sepsis; they found 59 (81%) patients with wild type, 14 (19%) patients with heterozygous type, and no mutant homozygous types.

In our study, the total white blood cell (WBC) count and absolute neutrophil count were within the normal range for age. However, another study found that infection is associated with low WBC count in early-onset neonatal sepsis [23]. However, total WBC count was found to be of little value in the EOS diagnosis and has a poor positive predictive accuracy [24].

Our patients showed normal platelet counts with a median 209 × 10³/μl. Despite the frequency of low platelet counts in infected infants seen in other studies, they are a nonspecific, insensitive, late indicator of sepsis [24] and are not very helpful in monitoring the response to therapy [25]. Platelet counts showed no significant relation with GPVI polymorphism groups in our study. Asfari etal. [13] also did not find a relation between platelet count in the wild and heterozygous groups.

Positive blood culture is considered a prominent issue in the detection and treatment of EOS. In our study, 62% of our patients had positive blood culture, whereas 38% showed negative blood culture. However, a negative culture does not exclude a diagnosis of EOS given that the sensitivity of blood cultures is only 50%–80%, especially in neonates whose mothers were treated with prophylactic antibiotics [26].

In the present study, we observed a significant association between the D-dimer levels and the platelet GPVI polymorphic groups, where the platelet GPVI mutant group (heterozygous and homozygous mutant haplotypes) showed higher levels than the wild-type group. Determination of D-dimer level is helpful in evaluating severity and prognosis in neonates with sepsis [27]. Elevated plasma level of D-dimer is caused by the breakdown of fibrin by plasmin and is a sign of activation of the hemostatic and the fibrinolytic systems. Thus, D-dimer is elevated during thrombosis, embolism, tissue injury, infections, malignancies, and hypoxia. This parameter is highly sensitive to rule out thromboembolic events where a negative D-dimer result rules out DIC with some certainty; however, its high level is nonspecific [28]. Moreover, Han etal. [29] have found that D-dimer levels can be considered an independent prognostic factor for in-hospital mortality in septic patients.

A remarkable finding was observed in one of our mutant homozygous patients whose gestational age was 37 weeks and was admitted at the age of 2 days old. She had a high D-dimer level >5000 μg/ml on admission. She had superior sagittal sinus thrombosis during her hospital stay and died on her 45th day after admission. Superior sagittal sinus thrombosis is an uncommon cerebrovascular accident that is based on the complex pathogenesis often resulting from a combination of inherited and acquired thrombophilic patterns [30].

No relation was found between GPVI polymorphism and SNAPII prognostic score, a finding that is parallel with Asfari etal. [13], who suggested other risk factors to be the cause of the sepsis severity rather than the gene polymorphism owing to higher morbidity score present within GPVI wild-type group rather than the heterozygous-type group.

Regarding the SIC and GPVI gene polymorphism, there was no significant relation between them in the present study. This is in contradiction with Skille etal. [31] who found a higher risk of venous thromboembolism in patients with cancer with mutant homozygous GPVI polymorphic subtype.

We found an association between the platelet GPVI polymorphic subtype and the survival in the septic neonates. There were more deaths in the mutant homozygous group. This is in agreement with another study that demonstrated patients with elevated platelet GPVI expression had a poor clinical outcome in different diseases such as stroke, myocardial infarction, and other cerebrocardiovascular accidents [32]. It was in contrast to Asfari etal. [13], who identified a significant improvement in morbidity outcome for patients with heterozygous polymorphic subtypes compared with wild-type patients.

It is likely that platelet GPVI haplotypes does not affect all inflammatory diseases. In fact, Michou etal. [33] found no association between GPVI haplotypes and the susceptibility and severity of rheumatoid arthritis. Thus, it raises the question of whether GPVI haplotypes are most relevant in the acute setting, such as sepsis, and less significant in the severity associated with chronic inflammation [13].

Conclusion

We found that different haplotypes for platelet GPVI gene polymorphism rs1613662 are present in full-term neonates with EOS, with the wild haplotype being more prevalent. Our findings suggest an association between this genetic polymorphism and neonatal sepsis regarding D-dimer levels and survival, where the mutant group, including the heterozygous mutant and homozygous mutant haplotypes, was associated with higher dimer levels, and the mutant homozygous group was associated with poor survival.

Future directions

The present study is one of few studies that investigated the role of platelet GPVI polymorphism in neonatal sepsis and associated coagulopathy. However, this study was conducted on a limited number of patients and yielded a small number of mutant candidates, which statistically restricted investigating their clinical characteristics.

Thus, conducting studies on a larger group of patients is needed to better understand the pathological events and shape future strategies for the needs of the clinical management of neonatal sepsis.

Acknowledgements

Human rights statements and informed consent: all procedures followed were in accordance with the ethical standards of our institutional committee with the Helsinki Declaration of 1964 and its later amendments. Informed consent was taken from the legal guardians of participants participating in this study.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

References

1.	Popescu CR, Cavanagh MM, Tembo B, Chiume M, Lufesi N, Goldfarb DM, et al. Neonatal sepsis in low-income countries: epidemiology, diagnosis and prevention. Expert Rev Anti Infect Ther 2020; 18:443–452.
2.	Edwards MS, Baker CJ Sepsis in the newborn. In: Gershon AA, Hotez PJ, Katz SL, Editors. Krugman’s infectious diseases of children. 11th ed. Philadelphia: Mosby 2004. p. 545–561.
3.	Chacko B, Sohi I Early onset neonatal sepsis. Indian J Pediatr 2005; 72:23.
4.	Good PI, Hooven TA Evaluating newborns at risk for early-onset sepsis. Pediatr Clin North Am 2019; 66:321–331.
5.	Wang Y, Ouyang Y, Liu B, Ma X, Ding R Platelet activation and antiplatelet therapy in sepsis: a narrative review. Thromb Res 2018; 166:28–36.
6.	Watkins NA, O’Connor MN, Rankin A, Jennings N, Wilson E, Harmer IJ, et al. Definition of novel GP6 polymorphisms and major difference in haplotype frequencies between populations by a combination of in‐depth exon resequencing and genotyping with tag single nucleotide polymorphisms. J Thromb Haemost 2006; 4:1197–1205.
7.	Heemskerk JW, Kuijpers MJ, Munnix IC, Siljander PR Platelet collagen receptors and coagulation. A characteristic platelet response as possible target for antithrombotic treatment. Trends Cardiovasc Med 2005; 15:86–92.
8.	Claushuis TA, de Vos AF, Nieswandt B, Boon L, Roelofs JJ, de Boer OJ, et al. Platelet glycoprotein VI aids in local immunity during pneumonia-derived sepsis caused by gram-negative bacteria. Blood 2018; 131:864–876.
9.	Rudzik R, Dziedziejko V, Rać ME, Sawczuk M, Maciejewska-Skrendo A, Safranow K, et al. Polymorphisms in GP6, PEAR1A, MRVI1, PIK3CG, JMJD1C, and SHH genes in patients with unstable angina. Int J Environ Res Public Health 2020; 17:7506.
10.	Ezumi Y, Uchiyama T, Takayama H Molecular cloning, genomic structure, chromosomal localization, and alternative splice forms of the platelet collagen receptor glycoprotein VI. Biochem Biophys Res Commun 2000; 277:27–36.
11.	Milanowski L, Pordzik J, Janicki PK, Postula M Common genetic variants in platelet surface receptors and its association with ischemic stroke. Pharmacogenomics 2016; 17:953–971.
12.	Arthur JF, Dunkley S, Andrews RK Platelet glycoprotein VI‐related clinical defects. Br J Haematol 2007; 139:363–372.
13.	Asfari A, Dent JA, Corken A, Herington D, Kaliki V, Sra N, et al. Platelet glycoprotein VI haplotypes and the presentation of paediatric sepsis. Thromb Haemost 2019; 119:431–438.
14.	Montague SJ, Delierneux C, Lecut C, Layios N, Dinsdale RJ, Lee CSM, et al. Soluble GPVI is elevated in injured patients: shedding is mediated by fibrin activation of GPVI. Blood Adv 2018; 2:240–251.
15.	Elek N, Sandor S, Balazs G, Dahlem P Pediatric sepsis: genetic considerations. J Child Sci 2017; 07:76–88.
16.	Sionova M, Blasko P, Jirous S, Vindis D, Rokyta R, Motovska Z Association of polymorphisms of platelet receptors GPIa (807C>T), GPVI (13254T>C), and P2Y12 (34C>T and H1/H2 haplotype) with increased risk of periprocedural bleeding in patients undergoing coronary angiography/percutaneous coronary intervention. Postepy Kardiol Interwencyinei 2017; 13:202.
17.	Töllner U Early diagnosis of septicemia in the newborn. Eur J Pediatr 1982; 138:331–337.
18.	Hassan A, Attia TH, Mokhtar W, Fakhr AE Polymorphism of Toll-like receptors type 2 gene in neonatal sepsis in NICU of Zagazig University Children Hospital. Zagazig Univ Med J 2020; 26:405–413.
19.	O’Hare FM, Watson RW, Molloy EJ Toll-like receptors in neonatal sepsis. Acta Paediatr 2013; 102:572–578.
20.	Cernada M, Serna E, Bauerl C, Collado MC, Pérez-Martínez G, Vento M Genome-wide expression profiles in very low birth weight infants with neonatal sepsis. Pediatrics 2014; 133:1203–1211.
21.	Snoep JD, Gaussem P, Eikenboom JCJ, Emmerich J, Zwaginga JJ, Holmes CE, et al. The minor allele of GP6 T13254C is associated with decreased platelet activation and a reduced risk of recurrent cardiovascular events and mortality: results from the SMILE–Platelets project. J Thromb Haemost 2010; 8:2377–2384.
22.	Bigalke B, Stellos K, Geisler T, Kremmer E, Seizer P, May AE, et al. Expression of platelet glycoprotein VI is associated with transient ischemic attack and stroke. Eur J Neurol 2010; 17:111–117.
23.	Hornik CP, Benjamin DK, Becker KC, Benjamin JrDK, Li J, Clark RH, et al. Use of the complete blood cell count in early-onset neonatal sepsis. Pediatr Infect Dis J 2012; 31:799.
24.	Polin RA Management of neonates with suspected or proven early-onset bacterial sepsis. Pediatrics 2012; 129:1006–1015.
25.	Simonsen KA, Anderson-Berry AL, Delair SF, Davies HD Early-onset neonatal sepsis. Clin Microbiol Rev 2014; 27:21–47.
26.	Arnon S, Litmanovitz I, Regev RH, Bauer S, Shainkin-Kestenbaum R, Dolfin T Serum amyloid A: an early and accurate marker of neonatal early-onset sepsis. J Perinatol 2007; 27:297–302.
27.	Hao L, Wang N Changes in plasma thrombomodulin and D-dimer levels and their clinical significance in neonates with sepsis. Zhongguo Dang Dai Er Ke Za Zhi 2013; 15:841–844.
28.	Veldman A, Fischer D, Nold MF, Wong FY Disseminated intravascular coagulation in term and preterm neonates. Semin Thromb Hemost 2010; 36:419–428.
29.	Han YQ, Yan L, Zhang L, Ouyang PH, Li P, Lippi G, et al. Performance of D-dimer for predicting sepsis mortality in the intensive care unit. Biochem Med 2021; 31:020709.
30.	Ramenghi LA, Govaert P, Fumagalli M, Bassi L, Mosca F Neonatal cerebral sinovenous thrombosis. Semin Fetal Neonatal Med 2009; 14: 278–283.
31.	Skille H, Paulsen B, Hveem K, Gabrielsen ME, Brumpton B, Hindberg K, et al. Genetic variation of platelet glycoprotein VI and the risk of venous thromboembolism. Haematologica 2020; 105:e358.
32.	Bigalke B, Krämer BF, Seizer P, Fateh-Moghadam S, Gawaz M, Lindemann S Diagnostic and therapeutic potentials of platelet glycoprotein VI. Semin Thromb Hemost 2010; 36:203–211.
33.	Michou L, Cornelis F, Baron M, Bombardieri S, Balsa A, Westhovens R, et al. Association study of the platelet collagen receptor glycoprotein VI gene with rheumatoid arthritis. Clin Exp Rheumatol 2013; 31:770–772.