Influence of altitude in anemia and risk assessment for chronic obstructive pulmonary disease :Sangeetha Thangavelu, Preethi Basavaraju, Vijaya Anand Arumugam, Rengarajan Rengasamy Lakshminarayanan, The Egyptian Journal of Haematology

ORIGINAL ARTICLE
Year : 2019 | Volume : 44 | Issue : 2 | Page : 134--140

Influence of altitude in anemia and risk assessment for chronic obstructive pulmonary disease

Sangeetha Thangavelu¹, Preethi Basavaraju², Vijaya Anand Arumugam³, Rengarajan Rengasamy Lakshminarayanan⁴,
¹ Medical Genetics and Epigenetics Laboratory, Department of Human Genetics and Molecular Biology, Bharathiar University, Coimbatore, India
² Biomaterials and Nanomedicine Laboratory, Department of Human Genetics and Molecular Biology, Bharathiar University, Coimbatore, India
³ Department of Human Genetics and Molecular Biology, Bharathiar University, Coimbatore, India
⁴ Department of Human Genetics and Molecular Biology, Bharathiar University, Coimbatore; Department of Animal Science, Bharathidasan University, Tiruchirappalli, India

Correspondence Address:
Sangeetha Thangavelu
Medical Genetics and Epigenetics Laboratory, Department of Human Genetics and Molecular Biology, Bharathiar University, Coimbatore–46, Tamil Naidu, 641 046
India

Abstract

Background Anemia is one of the most common blood disorders globally, affecting one-third of the world’s population, caused due to lack of iron in the human blood resulting in an abnormal hemoglobin range. Lung disorders are the third leading life-threatening disease worldwide, which is caused due to inflammation or injuries in the lungs or respiratory tract. Altitude increase is suspected to play a role in the induction and progression of both anemia and lung disorders. A point mutation SERPINA1 gene, a serine protease inhibitor, is directly linked with lung damage, has also been found to cause the anemic condition. Materials and methods The present study is aimed at analysis of variations of the biochemical parameters in both the diseases along with the altitudinal comparison, in order to predict the influence of altitude on them. The study was also aimed at depicting the association of anemia with lung disorders and hence SERPINA1 gene was examined for mutation to determine the risk for lung disorders. Results The biochemical and altitudinal comparison gave significant association, whereas, negative results were obtained in the genetic analysis. Conclusion All the obtained results clearly indicate that altitude has a major role in influencing the incidence and prevalence of anemia. It has also been found that all the anemic patients are not susceptible to lung disorders on a genetic basis.

How to cite this article:
Thangavelu S, Basavaraju P, Arumugam VA, Lakshminarayanan RR. Influence of altitude in anemia and risk assessment for chronic obstructive pulmonary disease.Egypt J Haematol 2019;44:134-140

How to cite this URL:
Thangavelu S, Basavaraju P, Arumugam VA, Lakshminarayanan RR. Influence of altitude in anemia and risk assessment for chronic obstructive pulmonary disease. Egypt J Haematol [serial online] 2019 [cited 2023 Mar 30 ];44:134-140
Available from: http://www.ehj.eg.net/text.asp?2019/44/2/134/271074

Full Text

Introduction

Anemia, a predominant blood disorder, affects one-third of the world’s population, in which the healthy erythrocytes or hemoglobin (Hb) is low, resulting in insufficient oxygen transportation [1],[2]. The oxygen content needed by the body cells is subjective to many environmental factors including altitudinal ranges [3]. The lungs are protected by alpha-1-antitrypsin, encoded by the SERPINA1 gene, which is mutated in chronic obstructive pulmonary disease, the third leading cause of global death. It has been diagnosed in 10–30% of anemia [4],[5],[6]. The present study investigates the genetic interlink between anemia and lung disorders in accordance with influence of altitude.

Materials and methods

Sample collection

A total of 62 individuals with an anemic condition irrespective of sex were included for this study. About 3 ml of venous blood was collected after receiving proper consent form each individual. Among these 62 individuals, 31 were from The Nilgiris (high-altitude region, ∼2240 m above the sea level) and 31 were from Coimbatore (low-altitude region, ∼411 m above the sea level). Before the collection of blood samples from the individuals, permission was obtained from the Institutional Ethics Committee. The blood was collected from patients by venipuncture method and stored in EDTA tubes at 4°C for further use.

The control samples were collected from 12 healthy individuals without any clinical or biochemical evidence of anemia. The control contained six samples from the high-altitude region and six from the low-altitude region. All the individuals were checked for recent blood transfusion and any medication is taken before 90 days of blood collection based on the oral questionnaire obtained. The questionnaire contained 32 questions covering the precise information regarding the anemic and lung disease history of the individual and their family, dietary habits, habitation, regular medications, and their day-to-day living environment. Questionnaires were collected from 114 individuals (57 from high altitude and 57 from low altitude) and a total of 62 individuals were scrutinized for further analysis.

Biochemical analysis

The biochemical parameters such as Hb, packed cell volume (PCV), total count (TC), and differential blood count (DC), which include the levels of polymorphs, lymphocytes, and monocytes; platelet count; blood urea and creatinine were considered for the analysis. About 1 ml of blood from the collected blood sample was taken for biochemical analysis. The biochemical parameters were subjected to analysis in the three-part hematological analyzer (BC-2800) available in the laboratory. The Hb is measured by using the cyanmethemoglobin method by measuring at 525 nm [7]. The hematocrit level is analyzed in the same analyzer, which uses the sodium lauryl sulfate method of determination based on the concentration. The TC, DC, and platelets are differentiated based on their volume by using electrical impedance technology, which applies the Coutler principle. Urea was measured by using the diacetyl monoxime method, whereas creatinine was estimated based on the Jaffe reaction [7],[8]. The significance of the biochemical estimations were analyzed by using Developers - IBM Corporation, Armonk, New York, USA [7],[9].

Mutational analysis

All the collected blood samples were subjected to isolation of the genetic material DNA by using the modified Miller method [10] and the presence of DNA is confirmed by 0.8% agarose gel electrophoresis with the Lee et al. [11], protocol. The obtained DNA was then subjected to mutational analysis by using the mutation-specific primer designed for the SERPINA1 gene G to A mutation, at the position 2, 89, 29, 474. The DNA of all the collected samples was screened for the mutation in the selected sequence (CA1ATTGCCACACACCATACCTTCCATATTCTCTCTGCAAGCCATTTTTTAAA1ATCCTACTTTCCAGCTGAGTAGATG) by using the designed forward (F) and reverse (R) primer (F-AATTGCCACACACCATACCT; R-TCTACTCAGCTGGAAAGTAGGAT) in a thermocycler (Eppendorf Nexus Gradient). The PCR was run at the following conditions: denaturation at 92°C, annealing at 60°C, renaturation at 72°C; and the hold temperature is 4°C [12]. The amplified DNA strands are then subjected to electrophoresis in 2% agarose gel and then viewed under gel documentation system [11]. The obtained DNA is subjected to blotting for further long-term storage.

Results

Biochemical, altitudinal, and genetic analyses of the collected samples yielded the following results.

Biochemical analysis

All the above-mentioned seven parameters were analyzed in the collected 25 low-altitude anemic samples followed by 25 high-altitude anemic samples and the 12 control samples. The Hb level of low-altitude and high-altitude anemic samples were considerably lower when compared with the control samples obtained from the respective altitudes. This proves Hb to be a major indicator of anemia irrespective of the altitude. The levels of PCV have also been observed to be lower in the case of anemic patients in both altitudes since PCV is the total percentage of the red blood cells; the levels of red blood cells combine with Hb level to indicate anemia in case of both altitudes. The TC level of anemic patients from lower altitudes is slightly lower and a higher altitude is slightly higher when compared with the control samples of low and high altitudes, respectively. This result shows that a TC level varies slightly in case of both altitudes but seemed to have no considerable relationship with anemic patients.

In case of DC, the range of polymorphs is found to be considerably higher than the control samples in both altitudes, whereas lymphocytes were seemed to be significantly lower than the control samples; in case of monocytes, the ranges did not differ noticeably. This result indicates the influence of the polymorph range on lymphocytes but not on monocytes in case of anemic patients, irrespective of altitudes. The level of platelets showed slightly higher ranges in plain region samples and in slightly lower ranges in hill region samples, which gives us a conclusion that the platelet range decreases with an increase in altitude. The ranges of urea and creatinine were observed to be higher than normal ranges in both the respective altitudes. This interpretation shows that both urea and creatinine have a role in anemic patients.

The mean, SD, and SE of the obtained samples are tabulated in [Table 1]. The obtained results of the biochemical analysis of low-attitude and high-altitude samples are represented in [Figure 1],[Figure 2],[Figure 3]. The comparison of Hb values of anemic samples with their respective altitude control samples gave a highly significant variation (P<0.001), whereas the PCV results were highly significant only for control samples against anemic samples (P<0.001). The polymorph value of DC estimation showed significant variation (P<0.005) for control samples of high altitude against anemic samples of the same altitude, whereas the lymphocyte ranges were significantly varied for low-altitude control and anemic samples (P<0.005) and highly significant for high-altitude samples (P<0.001). The other parameters such as TC, monocytes, platelet, urea, and creatinine did not show any significant variation. From all these observations, it has been clear that the observed parameters are influential in anemic patients with respect to their altitudes.{Table 1}{Figure 1}{Figure 2}{Figure 3}

Altitudinal analysis

The biochemical results obtained were subjected to altitudinal analysis. Even the control samples from the individuals devoid of anemia showed significant variation in biochemical parameters when compared altitudinal wise. This is represented in [Figure 4], which clearly indicates the variation in biochemical parameters of the obtained healthy individuals. The Hb and PCV levels of low-altitude healthy individuals were lower when compared with higher-altitude individuals. At the same time, the levels of TC and urea were higher in low-altitude individuals, whereas the polymorphic count and platelets were lower in them when compared with the high-altitude individuals. The monocytes and creatinine did not show significant variation in accordance with the difference in altitudes. Statistical comparison of Hb values of control samples alone from low and high altitudes gave highly significant variation (P<0.001) but not clinically significant. Since Hb is the predominant factor which causes anemia, these observations clearly indicate the influence of altitude in provoking anemia.{Figure 4}

Genetic analysis

The DNA has been isolated from the collected samples and the presence of DNA was confirmed by agarose gel electrophoresis in 0.8% gel ([Figure 5]). The genetic analysis was carried in a thermocycler for both low-attitude and high-altitude samples under the above-mentioned primer conditions. All the subjected DNA samples showed negative amplification of the single-nucleotide polymorphism in SERPINA1 gene ([Figure 6]), which in turn gives a conclusion that the anemic patients so far considered in this study are not susceptible to lung disorders due to a genetic mutation in their upcoming years.{Figure 5}{Figure 6}

Discussion

Anemia, a most predominant blood disorder worldwide, was analyzed for the seven hematological parameters in two different altitudes [6],[13]. It has been reported that there is a considerable variation in the blood parameters of persons living in varying sea levels. The most common cause of the anemic condition in developing countries is nutritional deficiencies [14]. Hb is the important component of red blood cells; its predominant function is to transport oxygen throughout the body tissues. It is also involved in the transport of carbon dioxide and nutrients. The lack of oxygen supply to the body tissues results in the anemic condition. PCV (also referred as hematocrit) is the percentage of red blood cells in the whole blood. The reduced concentration of PCV may be an indication of abnormal red cell development [15]. TC is the total number of white blood cells per cubic millimeter of blood, whereas DC denotes the percentage of each type of white blood cells present in the blood [8],[16]. The smallest cells of our blood, which recognizes and binds to damaged blood vessels are the platelets. The urea level in the blood is used to measure the proper functioning of kidneys; it can also be done along with creatinine analysis for the detection of malnutrition [17],[18]. The blood urea level and creatinine elevates in case of kidney damage, which may cause an anemic condition, whereas the fluid accumulation may also result in lung problems [19]. The malnutrition of iron may cause the anemic condition and hence measured here for the diagnosis.

In the present study, the parameters showed decreased and increased values when compared with the control samples from the respective altitudes. In case of the control samples from two different altitudes, the variations were significant. The oxygen-carrying capacity reduces with an increase in altitude due to the decline in atmospheric pressure [20]. This may cause a decline in red blood cell destruction, which in turn may make the individual anemic. Furthermore, the statistical analysis of the biochemical parameters showed highly significant variation in Hb levels of two different altitudes. Hence, the null hypothesis has been rejected; in other words, our framed hypothesis on altitude has been accepted. This gives evidence for the framed hypothesis that altitude influences the prevalence of anemia.

Lung disorder is any type of medical condition that affects the normal functioning of the lungs. Anemia has been observed in about 10–30% of patients with lung function abnormality [21]. One of the common primary factors that have been found to have a higher association with fatal diseases such as lung disorders, heart diseases etc. is altitude ranges, but the association is pleiotropic. The altitude variation plays an important role in the oxygen-carrying capacity, which in turns affects the blood cell composition and respiratory organs [22]. SERPINA1 gene is the member of serine protease inhibitors (SERPINs) superfamily, which has a major role in inhibiting proteolysis [23],[24]. The specific role of this gene is to protect our lung tissue from inflammation by the action of the proteolytic enzyme neutrophil elastase released by leukocytes at the site of infection. The mutation in the SERPINA1 gene henceforth directly leads to the lung damage.

The latter part of the study is analyzing the risk for the lung disorders in anemic patients. This study was carried out on a genetic basis. The genetic alteration in the SERPINA1 gene, which is responsible for the lung disorders, has not been found in the collected anemic samples. Even though an increase in the altitude has been reported as a risk factor for lung disorder, the specific mutation is absent in the collected samples. This brings us to the conclusion that all the anemic patients are not susceptible to lung disorders unless or until the spontaneous mutation occurs. This study maybe continued with a large population size and various clinical conditions.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

References

1	Pareek P, Hafiz A. A study on anemia related knowledge among adolescent girls. Int J Nutr Food Sci 2015; 4:273–276.
2	Northrop-Clewes CA, Thurnham DI. Biomarkers for the differentiation of anemia and their clinical usefulness. J Blood Med 2013; 4:11–22.
3	Sankaran VG, Weiss MJ. Anemia: progress in molecular mechanisms and therapy. Nat Med 2015; 2:221–230.
4	Gettins PG. Serpin structure, mechanism, and function. Chem Rev 2002; 102:4751–4804.
5	DeMeo DL, Silverman EK. Alpha1-antitrypsin deficiency. 2: genetic aspects of alpha (1)-antitrypsin deficiency: phenotypes and genetic modifiers of emphysema risk. Thorax 2004; 59:259–264.
6	GBD. 2013 mortality and causes of death, collaborators. Global, regional, and national age-sex specific all-cause and cause-specific mortality for 240 causes of death, 1990–2013: a systematic analysis for the Global Burden of Disease Study. Lancet 2013; 385:117–171.
7	Sachdev R, Tiwari AK, Goel S, Raina V, Sethi M. Establishing biological reference intervals for novel platelet parameters (immature platelet fraction, high immature platelet fraction, platelet distribution width, platelet large cell ratio, platelet-X, plateletcrit, and platelet distribution width) and their correlations among each other. Indian J Pathol Microbiol 2014; 57:231–235.
8	Dean L. Blood groups and red cell antigens. Bethesda, MD: National Center for Biotechnology Information (US); 2005.
9	Davis BH, Barnes PW. Automated cell analysis: principles. In Laboratory Hematology Practice. Wiley Online Library; 2012. doi:10.1002/9781444398595.ch3
10	Miller JH. Experiments in molecular genetics. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press; 1972.
11	Lee PY, Costumbrado J, Hsu CY, Kim YH. Agarose gel electrophoresis for the separation of DNA fragments. J Vis Exp 2012; 62:3923.
12	Mullis KB, Falcoona F, Scharf S, Saiki R, Horn G, Erlich H. Specific enzymatic amplification of DNA in vitro; the polymerase chain reaction. Cold Spring Harb Symp Quantit Biol 1986; 51:263–273.
13	Janz TG, Johnson RL, Rubenstein SD. Anemia in the emergency department: evaluation and treatment. Emerg Med Pract 2013; 15:1–15.
14	Kotecha PV. Nutritional anemia in young children with focus on Asia and India. Indian J Comm Med 2011; 36:8–16.
15	Purves William K, David S, Orians GH, Heller HC. Life: the science of biology. Cell Biochem Funct 2004; 7:954.
16	Blumenreich MS. The white blood cell and differential count; clinical methods: the history, physical, and laboratory examinations. NCBI 1990; 3: Chapter 153.
17	Michelson AD. Platelets. Sci Technol Books 2013; 3:3–25.
18	Allen PJ. Creatine metabolism and psychiatric disorders: Does creatine supplementation have therapeutic value. Neurosci Biobehav Rev 2012; 36:1442–1462.
19	Stein A. Understanding treatment optionsor renal therapy. Deerfield, Illinois: Baxter International Inc.; 2007.
20	Al-Sweedan SA, Alhaj M. The effect of low altitude on blood count parameters. Hemtol Oncol Stem Cell Ther 2012; 5:158–161.
21	Guo J, Zheng C, Xiao Q, Gong S, Zhao Q, Wang L et al. Impact of anaemia on lung function and exercise capacity in patients with stable severe chronic obstructive pulmonary disease. BMJ Open 2015; 5:e008295.
22	Horner A, Soriano JB, Puhan MA, Studnicka M, Kaiser B, Vanfleteren LEGW et al. Altitude and COPD prevalence: analysis of the PREPOCOL-PLATINO-BOLD-EPI-SCAN study. Respir Res 2017; 18:162.
23	National Center for Biotechnology Information (US). Genes and Disease. Bethesda, MD: National Center for Biotechnology Information (US); 1998. Alpha-1-antitrypsin deficiency.
24	Brode SK, Ling SC, Chapman KR. Alpha-1 antitrypsin deficiency: a commonly overlooked cause of lung disease. CMAJ 2012; 184:1365–1371.